What it does

This tool converts data from Solexa format to FASTA format (scroll down for format description).

Example

The following data in Solexa-FASTQ format:

@CSHL_4_FC042GAMMII_2_1_517_596
GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT
+CSHL_4_FC042GAMMII_2_1_517_596
40 40 40 40 40 40 40 40 40 40 38 40 40 40 40 40 14 40 40 40 40 40 36 40 13 14 24 24 9 24 9 40 10 10 15 40

Will be converted to FASTA (with 'rename sequence names' = NO):

>CSHL_4_FC042GAMMII_2_1_517_596
GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT

Will be converted to FASTA (with 'rename sequence names' = YES):

>1
GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT

This tool is based on FASTX-toolkit by Assaf Gordon.